Figure 1: Agarose gel electrophoresis 2% showing PCR products of invA gene (284 bp) Specific for characterization of all Salmonella species. Lanes (1) to (6): Positive Salmonella species for invA gene.
Lane L: Molecular marker DNA ladder (100 bp) (cat. No. 239035) supplied from QIAGEN (USA)
Lane Pos: Control positive strain for invA gene
Lane Neg: Control negative
Lane 1: Salmonella typhi
Lane 2: Salmonella typhimurium
Lane 3: Salmonella enteritidis
Lane 4: Salmonella paratyphi A
Lane 5: Salmonella papuana
Lane 6: Salmonella vircho

Full Text
Shaltout FA1* El-Toukhy EI2 Abd El-Hai MM3
1Department of Food Control, Faculty of Veterinary Medicine, Benha University, Egypt2Department of Biotechnology, Animal Health Research Institute, Dokki, Egypt
3General organization of veterinary services, Egypt
*Corresponding author: Shaltout FA, Department of Food Control, Faculty of Veterinary Medicine, Benha University, Egypt, Tel: 002 01006576059; E-mail: [email protected]
A total of one hundred and twenty random samples of luncheon, fresh raw sausage, frozen packed minced meat and frozen meat (30 samples of each) were collected from different supermarkets at Kalyobia Governorate. The collected samples were transferred directly to the laboratory in an ice box under complete aseptic conditions. The samples were immediately examined bacteriologically for the detection of Salmonellae. The Salmonellae isolates were confirmed by PCR.
Salmonellae failed to be detected in luncheon beef samples but the percentage of Salmonellae in fresh sausage was 10% and the isolated serovars were S. typhi (3.3%), S. typhimurium (3.3%) and S. enteritidis (3.3%). In frozen packed minced meat, the percentage of Salmonellae was 6.7% and the isolated serovars were S. typhi (3.3%) and S. typhimurium (3.3%) and in frozen meat, the percentage of Salmonellae was 13.3% and the isolated serovars were S. papuana (6.7%), S. paratyphi A (3.3%) and S. vircho (3.3%). The virulence of the isolated strains was confirmed through molecular technique by polymerase chain reaction (PCR) of the isolated Salmonellae strains for detection of the virulence factor (invA gene).
Luncheon; Sausage; Minced meat; Frozen meat; Salmonellae; Serovars; PCR
Food borne illnesses are considered by the World Health Organization (WHO) as diseases either infectious or toxic made by causative agents in ingested food. The reports in 2005 recorded 1.8 million people died from diseases causing diarrhea and high proportion of which was attributed to contamination of food and drinking water [1]. Salmonellae food poisoning is one of the most common and widely distributed diseases in the world [2], estimated to cause 1.3 billion cases of gastroenteritis and 3 million deaths worldwide [3].
Recently, some food borne diseases are considered as emerging diseases. Various food borne pathogens have been identified for food borne illness. Campylobacter, Escherichia coli O157:H7, Listeria monocytogenes and Salmonellae are found to be responsible for most of food origin outbreaks [4].
Meat products such as sausage, luncheon and minced meat are more popular because they are considered as quick easily prepared meat meals and solve the problem of fresh meat shortage which is not within the reach of many peoples.
Microorganisms may contaminate meat products during a long chain of processing from the time of preparation, handling, processing, distribution and storage as well as marketing. Such contamination may render the products of inferior quality or even unfit for human consumption and at times may constitute a public health hazard. The possibility of contamination of meat products with food poisoning bacteria especially Salmonellae organisms has been extensively reported [5].
Traditional and conventional methods for identification of microbial pathogens depend on specific bacteriological and biochemical identification [6], which are time consuming, laborious and less accurate [7] and slow because Salmonellae needs 5-7 days to confirm its presence in meat products [8]. Several Polymerase Chain Reaction (PCR) assays have been developed by targeting various Salmonellae genes, such as invA [9,10]. The invA gene, is widely used as a target in PCR assays for Salmonella detection [11-13].
Isolation and identification of Salmonellae
The techniques adopted were carried out according to ICMSF (1978) [14]. Samples were cultivated for the isolation of Salmonellae species on MacConkey agar. After 24 h of incubation at 37°C, suspected colonies with typical characteristics of Salmonellae were sub-cultured on XLD (Xylose Lysine Deoxycholate) agar for 24 h at37°C and Salmonella shigella (S.S) agar plates then incubated at 37°C for 24 h.
Molecular identification of Salmonellae isolates by PCR
Extraction of genomic DNA according to QIAamp DNA mini kit instructions: Genomic DNA was extracted from cell suspensions of bacteria grown overnight on XLD broth at 37°C using QIAamp® DNA Mini kit from Qiagen according to Lee SH, et al. [15]. A single colony from Salmonellae was resuspended in 3 ml XLD liquid media and grown overnight at 37°C. The bacterial culture was precipitated by centrifugation in a microcentrifuge at 5000 xg for 10 min. The bacterial pellets were resuspended in 180 µl AL buffer (supplied in the QIAamp DNA Mini Kit) for complete lysis. The samples were immediately cooled on ice for 5 min, and the cell lysates were digested with 20 µl of proteinase K (final concentration 800 μg/ml) at 56°C for 3 h. 200 μl ethanol (96 to 100%) was added to each tube and vortexed for 15 s. The mixtures were loaded onto the QIAamp Mini spin column and centrifuged at 6000 xg for 1 min. The filtrate was discarded and the spin column was placed in a clean collection tube (2 ml). A 500 μl of AW1 wash buffer was added to the QIAamp spin column and centrifuged at 6000 xg for 1 min. The washing step was repeated twice using 500 μl of washing buffer AW2. To elute bacterial DNA, 100 μl elution buffer (AE) was added to the center of the column, and the column was incubated at 37°C for 5 min then centrifuged at 20,000 xg for 1 min. DNA purity and quantity was determined using spectrophotometer (GeneSys 10UV, Thermo Scientific, USA).
Oligonucleotide primers for Salmonellae spp. (invA gene): Primer sets for the pathotypes and virulence genes for the isolated Salmonellae spp. according to Oliveira, et al. [16] (Table 1).
| Primer | Sequence | Amplified product |
| invA | GTGAAATTATCGCCACGTTCGGGCAA | 284 bp |
| TCATCGCACCGTCAAAGGAACC |
Table 1: Primers used for the detection of Salmonellae sp.
DNA amplification: The samples were done in BioRad Thermal cycler (T100-England) with the following thermal profile: initial denaturation at 95°C for 5 min then denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension for 30 sec at 72°C for 35 cycles and after the last cycle, the mixture was incubated for final extension at 72°C for10 min.
Detection of PCR products according to Sambrook J, et al. [17]: Amplified products were detected in 1.5% agarose gel electrophoresis pre-stained with ethidium bromide, at 80 V for 1 hour. Specific amplicons were observed under ultraviolet transillumination, compared with the marker, the gel was transferred to UV cabinet, and the gel was photographed by a gel documentation system and the data was analyzed through computer software.
In this work, a total of one hundred and twenty random samples of meat products, (30 samples of luncheon beef, 30 samples of fresh sausage, 30 samples of frozen minced meat and 30 samples of frozen meat) were examined for Salmonellae. The virulence of the isolated serotypes was confirmed by detection of the invA gene which is responsible for the pathogenicity of Salmonella serotypes.
Incidence of Salmonellae
Salmonellae were detected in 7.5 % of the examined meat product samples. The percentage of Salmonellae in luncheon meat, fresh sausage, frozen minced meat and frozen meat was 0%, 10% and 6.7% and 13.3% respectively (Table 2).
| Samples | No. of samples | Positive | % |
| Luncheon (beef) | 30 | 0 | 0 |
| Fresh sausage | 30 | 3 | 10 |
| Frozen packed minced meat | 30 | 2 | 6.7 |
| Frozen meat | 30 | 4 | 13.3 |
| Total | 120 | 9 | 7.5 |
Table 2: Incidence of Salmonellae in the examined meat products and frozen meat samples.
The results present in table 2 revealed that Salmonellae failed to be detected in the examined luncheon samples.
These results agree with that reported by Gouda HI, Saleh AA, Edris A, Nashed-Heba F, Moussa MM, et al, Fathi S, et al, Aiedia HA, AbdEl-Aziz A, S, et al., Ouf-Jehan M, Eleiwa-Nesreen ZH, Edris AM, et al, Abd El-Kader-Hanaa A, et al. and Shaltout FA, et al. [18-30]. The result disagrees with that reported by Mohamed (1988) [31] who recorded that Salmonellae could be detected out of 100 examined luncheon samples and Mohamed K [32] who recorded that Salmonellae could be detected out of 10 examined luncheon samples (10%).
The results presented in table 2 revealed that Salmonellae were present in 10% of the examined samples of fresh sausage. Similar results were recorded by Edris AM, et al. [28]. Nearly similar results were obtained by Ouf-Jehan M, Eleiwa-Nesreen ZH and Mohamed FA [26,27,33] with an incidence of (8%) for each of them, Cabedo L, et al. (11.1) and El-Kader HA, et al. (13.3) [34,29]. While higher results were reported by Banks JG, et al. [35] (55 %) and Shaltout FA, et al. (16%) [30]. Lower results obtained by Zaki EMS (5%) and Ahmed AAH, et al. (5 %) [36,37]. Some investigators failed to detect Salmonellae in meat products as Vazgecer B, et al. and Ismail AH [38,39].
It’s clear from the results reported in table 2 that 6.7% of the examined samples of frozen packed minced meat were positive for Salmonellae. This result agrees with that of Edris AM, et al. and ElKader HA, et al. [28,29].
Nearly similar results were obtained by Abd El-Aziz AS, et al. (5%), and Shaltout FA (6%) [25,40]. While lower results were recorded by Roberts TA, et al. and Abd El-Atty NS, et al. [41,42] as (2%) for each of them. On the other hands, higher results were reported by Molla B, et al. (32.7%), Ejeta G, et al. (14.4%), Mohamed K (40%), AL-Jobori KM, et al. (36%), and Shaltout FA, et al. (40%) [43,44,32,7,30].
Salmonellae were present in 13.3 % of the examined samples of frozen meat (Table 2). Nearly similar results were recorded by El-Kader HA, et al. [29] (10%), but higher results reported by AL-Jobori KM, et al. [7] (40%) and Mahmood NR, et al. [45] who isolated Salmonellae spp. at a rate of 24.76% and Elsayed MS, et al. (18%) [46].
From the results recorded in table 2 it’s clear that frozen meat had the higher incidence of Salmonellae contamination followed by fresh sausage and frozen packed minced meat while Salmonellae could not be detected in luncheon.
The absence of Salmonellae in luncheon meat may be due to the addition of food additives such as spices and preservatives, which have an antimicrobial activity and inhibit survival and multiplication of micro-organisms [47]. This also may be attributed to the exposure to high temperature during processing and cooking procedures.
High incidence of Salmonellae in fresh sausage may be due to faults in certain practices of slaughtering and handling processes such as the use of contaminated knives, tools, rags, saws, boards, etc., as well as unhygienic slaughtering, dressing, washing, transporting, handling and cutting in abattoirs and butcher shops that affect the incidence of Salmonellae. High incidence of Salmonellae in fresh sausage may be due to the fact that this product is made from raw meat in addition to natural casing which is often used in their manufacture and may be act as an important source for Salmonella [48].
The high incidence of Salmonellae in frozen packed minced meat may be due to cutting and contamination of meat besides the increase in its water and oxygen contents as well as contamination from grinders, air, packaging materials and hands of the workers. Temperature rise (2-4°C) during grinding could also increase the incidence of Salmonella organisms [49].
The incidence of Salmonellae in frozen meat may be originated through a different infected touch of food handlers and butchers, improper clothing, fecal hand contamination, may be through rodent and other insects or unhygienic practice in slaughter house area. There is a risk of chances for developing Salmonellosis is major due to survival of Salmonella at very low temperature too. They may come in different serotypes S. enteridis, S. typhi, S. typhimurium, etc. [50].
Serotyping of the isolated Salmonellae
From the result recorded in table 3, it is clear that 3 Salmonella serovars were identified from fresh sausage samples, 1 (3.3 %) strains as S. typhi, 1 (3.3 %) strains as S. typhimurium and 1 (3.3%) strain as S. enteritidis.
| Salmonellaserovars | No. | %* | %** |
| S.typhi | 1 | 33.3 | 3.3 |
| S.typhimurium | 1 | 33.3 | 3.3 |
| S. enteritidis | 1 | 33.3 | 3.3 |
Table 3: Serotyping of Salmonellae isolated from the examined fresh
sausage samples (n=30).
%*=percentage collected from only positive Salmonella samples
%**=percentage collected from total examined samples
Similar results were obtained by Abd EL-Kader-Hanaa, et al. [29] where they could isolate S. typhi and S. typhimurium with a percentage of 3.3 % for each strain but higher results were recorded for S. enteritidis with a percentage of 6.7%.
Nearly similar results were obtained by Rao NM, et al. [51] where they could isolate S. typhimurium and S. enteritidis with a percentage of 2.5 % for each strain, Edris AM, et al. [28] where they could isolate S. typhi, S. typhimurium and S. enteritidis with a percentage of 4%, 4% and 2% respectively and Shaltout FA, et al. [30] where they could detect S. enteritidis (4%).
From the result recorded in table 4 it is clear that 2 Salmonellae serovars were identified in the examined frozen packed minced meat samples and identified as 1 (3.3%) strain as S. typhimurium and 1 (3.3%) strain as S. typhi.
| Salmonellaserovars | No. | %* | %** |
| S.typhi | 1 | 50 | 3.3 |
| S.typhimurium | 1 | 50 | 3.3 |
Table 4: Serotyping of Salmonellae isolated from the examined frozen packed minced meat samples (no=30).
%*=percentage collected from only positive Salmonella samples
%**=percentage collected from total examined samples
This result agrees with that obtained by El-Kader HA, et al. [29] where they recorded that the incidence of S. typhimurium in the examined frozen packed minced meat samples was 3.3 %.
Nearly similar results were obtained by Edris AM, et al. [28] where they could isolate S. typhi (2%) and S. typhimurium (4%) and Shaltout FA, et al. [30] where they could detect S. typhi (4%), but higher results were recorded for S. typhimurium (8%).
From the result recorded in table 5 it’s clear that 3 Salmonella serovars were identified in the examined frozen meat samples and identified as 2 (6.7%) strains as S. papuana, 1 (3.3%) strain as S. paratyphi A and 1 (3.3%) strain as S. vircho. Higher results were reported by Elsayed MS, et al. [46] where they stated that S. paratyphi A was detected in 8/18 (44.44%) positive samples.
| Salmonellaserovars | No. | %* | %** |
| S.papuana | 2 | 50 | 6.7 |
| S.paratyphi A | 1 | 25 | 3.3 |
| S. vircho | 1 | 25 | 3.3 |
Table 5: Serotyping of Salmonellae isolated from the examined frozen meat samples (n=30).
%*=percentage collected from only positive Salmonella samples
%**=percentage collected from total examined samples
Identification of Salmonella by PCR
The specificity of the oligonucleotide primers were carried out by testing of all Salmonella strains with PCR using the primer pairs targeting the invA gene (specific for all members of Salmonella species).
All the 6 Salmonella isolates detected by bacteriological examination were tested by PCR using the same primer pair after selective enrichment media on XLD agar and all Salmonella serovars were positive for amplification of 284 bp fragments of invA gene as shown in figure 1.
The present study supports the ability of this specific primer set to confirm the isolates as Salmonella. Isolates were subjected to Salmonella specific gene (invA) and were confirmed as Salmonella positive by the predicted product of 284 bp DNA fragments. The results obtained in the present study were in accordance with Nagappa K, et al., Abd ElKader-Hanaa A, et al., and Moustafa NY, et al. [52,29,53] where they could amplify 284 bp of invA gene which is specific for demonstration and characterization of the isolated Salmonella species by using PCR.
The ability of Salmonella specific primers to detect Salmonella species rapidly and accurately in the present study is primarily due to the primer sequences that are selected from the gene invA of S.typhimurium as reported by Darwin KH, et al., Nucera DM, et al., and Craciunas C, et al. [54-56].
Culture techniques are universally recognized as the standard methods for the detection of bacterial pathogens, such as Salmonella in food stuffs [57]. These techniques generally take longer time [58] and are less sensitive compared to PCR based methods [55,56]. The use of invA gene specific PCR method in most diagnostic and research laboratories is possible and through the molecular basis of Salmonella identification techniques, this method is the simplest and less expensive.
In conclusion, PCR is a rapid and specific method for the detection of the virulent strains of Salmonellae in meat products and frozen meat samples. It gives the ability to detect Salmonella cells and identify the virulence of the isolated strains within a little time and PCR was demonstrated to be accurate methods for S. enterica identification.
- World Health Organization (WHO) (2007) Food Safety and FoodBorne Illness-Fact Sheet N° 237. Geneva, Switzerland. [Ref.]
- World Health Organization (WHO) (2018) Salmonella (nontyphoidal). Geneva, Switzerland. [Ref.]
- Bhunia AK (2008) Foodborne Microbial Pathogens: Mechanisms and Pathogenesis. Springer Science & Business Media, USA. [Ref.]
- Chemburu S, Wilkins E, Abdel-Hamid I (2005) Detection of Pathogenic Bacteria in Food Samples Using Highly-Dispersed Carbon Particles. Biosens Bioelectron 21: 491-499. [Ref.]
- Abd El-Aziz-Reham A (2004) Microbial evaluation of some meat products. MVSc Thesis (Meat hygiene) Fac Vet Med Moshtohor Zagazig University (Benha Branch), Egypt.
- Aycicek H, Aydogan H, Kucukkaraaslan A, Baysallar M, Basustaoglu AC (2004) Assessment of the Bacterial Contamination on Hands of Hospital Food Handlers. Food Control 15: 253-259. [Ref.]
- AL-Jobori KM, AL-Bakri AK, AL-Baity BH (2015) Detection of Salmonella spp. in Different Food Sources in Baghdad City: A Comparison between Conventional and Chromogenic Methods. Int J Adv Res Biol Sci 2: 171-184. [Ref.]
- Helmy-Noha A (2003) Application of biotechniques for detection and discrimination of some pathogenic microorganisms in chicken meats. PhD Thesis (Meat Hygiene), Fac Vet Med, Cairo University, Egypt.
- Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galán JE, et al. (1992) Amplification of an invA Gene Sequence of Salmonella typhimurium by Polymerase Chain Reaction as a Specific Method of Detection of Salmonella. Mol Cell Probes 6: 271-279. [Ref.]
- Moussa IM, Gassem MA, Al-Doss AA, Mahmoud WAS, Mawgood AAL (2010) Using Molecular Techniques for Rapid Detection of Salmonella Serovars in Frozen Chicken and Chicken Products Collected from Riyadh, Saudi Arabia. Afr J Biotechnol 9: 612-619. [Ref.]
- Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M (2005) Loop-Mediated Isothermal Amplification for the Rapid Detection of Salmonella. FEMS Microbiol Lett 253: 155-161. [Ref.]
- Singer RS, Cooke CL, Maddox CW, Isaacson RE, Wallace RL (2006) Use of Pooled Samples for Detection of Salmonella in Feces by Polymerase Chain Reaction. J Vet Diagn Invest 18: 319-325. [Ref.]
- Shanmugasamy M, Velayutham T, Rajeswar J (2011) InvA gene specific PCR for detection of Salmonella from broilers. Vet World 4: 562-564. [Ref.]
- International Commission on Microbiological Specification for Foods (1978) Microorganisms in Foods 1: Their Significance and Methods of Enumeration: A Publication of the International Commission on Microbiological Specifications for Foods (ICMSF) of the International Association of Microbiological Societies. 2nd Edition, University of Toronto press 434. [Ref.]
- Lee SH, Jung BY, Rayamahji N, Lee HS, Jeon WJ, et al. (2009) A Multiplex Real-Time PCR for Differential Detection and Quantification of Salmonella spp., Salmonella enterica Serovar Typhimurium and Enteritidis in Meats. J Vet Sci 10: 43-51. [Ref.]
- Olivera SD, Rodenbusch CR, Ce MC, Rocha SLS, Canal CW (2003) Evaluation of Selective and Non Selective Enrichment PCR Procedures for Salmonella Detection. Lett Appl Microbiol 36: 217- 221. [Ref.]
- Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: A Laboratory Manual, 2nd Edition. Cold spring Harbor Laboratotry press, New York, USA. [Ref.]
- Gouda HI (1991) Indicator Organisms in Some Meat Products. MVSc Thesis (Meat Hygiene), Fac Vet Med, Alexandria University, Egypt.
- Saleh AA (1991) Hygienic and Economic Aspects of Some Microorganisms Affecting Production and Quality of Some Meat Products. MVSc Thesis (Meat hygiene), Fac Vet Med, Alexandria University, Egypt.
- Edris A (1993) Isolation and Identification of E. coli and Salmonella from Ready to Eat Meat Products. Zag Vet Med J 21: 187-193.
- Nashed-Heba F (1993) Salmonella and Enteropathogenic E. coli serotypes in meat products. MVSc Thesis (Meat Hygiene), Fac Vet Med, Moshtohor Zagazig University (Benha Branch), Egypt.
- Moussa MM, Awad HA, Yassien MM, Gouda H (1993) Microbial Quality of Some Meat Products. Alex Vet Med J 41: 59-62.
- Fathi S, El-khateib T, Moustaf S, Hassanein K (1994) Salmonellae and Enteropathogenic E.coli in Some Locally Manufactured Meat Products.
- Aiedia HA (1995) Quality Investigation into Room Kept Traditional Meat Products in Egypt. PhD Thesis (Meat Hygiene), Fac Vet Med, Cairo University, Egypt.
- Abd El-Aziz AS, El-Neklawy EIS, Hussien A, Niazi Z (1996) Food Poisoning Microorganisms in Some Locally Meat Products. Vet Med J Giza 44: 691-698.
- Ouf-Jehan M (2001) Microorganisms of Sanitary Importance in Some Meat Products and their Additives. PhD Thesis (Meat Hygiene), Fac Vet Med, Cairo University, Egypt.
- Eleiwa-Nesreen ZH (2003) Effect of Chemical Preservatives on Food Poisoning Bacteria in Some Locally Manufactured Meat Products. PhD Thesis (Meat hygiene), Fac Vet Med, Zagazig University, Egypt.
- Edris AM, Shaltout FA, Salem GH, El-Toukhy EI (2011) Plasmid Profile Analysis of Salmonellae Isolated from Some Meat Products. Benha Vet Med J 172-178.
- . El-Kader HA, EL-Toukhy EI, Hanan AF, Masoud EA, EL-Berbawy SM (2015) Molecular Study on Virulence Gene of Some Isolates of Salmonellae Isolated from Chicken Meat and Some Meat Products. Anim Health Res J 3: 310-317.
- Shaltout FA, Salem-Amani M, Khater-Dalia F, Lela-Radwa A (2016) Studies on Bacteriological Profile of Some Meat Products. Benha Vet Med J 31: 43-49.
- Mohamed AS (1988) Salmonella in Locally Produced Meat Products. MVSc thesis (Meat Hygiene) Faculty of Veterinary Medicine, Cairo University, Egypt.
- Mohamed K (2013) Prevalence of Salmonella in Meat Products. Global Veterinaria 11: 685-688. [Ref.]
- Mohammed FA (2011) The Incidence of Enterobacteriaceae Causing Food Poisoning in Some Meat Products. Adv J Food Sci Technol 3: 116-121. [Ref.]
- Cabedo L, Picart i Barrot L, Teixidó i Canelles A (2008) Prevalence of Listeria monocytogenes and Salmonella in Ready-To-Eat Food in Catalonia, Spain. J Food Prot 71: 855-859. [Ref.]
- Banks JG, Board RG (1983) The Incidence and Level of Contamination of British Fresh Sausages and Ingredients with Salmonellas. J Hyg (Lond) 90: 213-223. [Ref.]
- Zaki EMS (2003) Risk Assessment of Ready Prepared Meat Products. PhD Thesis (Meat Hygiene), Fac Vet Med, Cairo university, Egypt.
- Ahmed AAH, Abd-El-Rahman HA, Moustafa MK (1988) Incidence of Enterobacteriaceae in Some Selected Food Stuffs. Assuit Vet Med J 20: 104-109.
- Vazgecer B, Ulu H, Oztan A (2004) Microbiological and Chemical Qualities of Chicken Doner Kebab Retailed on the Turkish Restaurants. Food Control 15: 261-264. [Ref.]
- Ismail AH (2008) Effential microbiological quality control points associated with some locally processed meat products. MVSc Thesis, Faculty of Vet Med, Cairo University, Egypt.
- Shaltout FA (1998) Incidence of Proteolytic and Psychrotrophic Organisms in Some Meat Products. Alex J Vet Science 14: 97-107.
- Roberts TA, Britton CR, Hudson WR (1980) The Bacteriological Quality of Minced Beef in the UK. J Hyg Lond 85: 211-217. [Ref.]
- Abd El-Atty NS, Meshref AMS (2007) Prevalence of Salmonella and E. coli O157 in Some Foods. 5th Scientific Conference, Beni-Suef Vet Med J 73-78.
- Molla B, Kleer J, Sinell H (1994) Detection of Salmonella in Food by Immuno-magnetic Separation. Archiv Fur Lebensmittelhgiene 45: 112-113.
- Ejeta G, Molla B, Alemayehu D, Muckle A (2004) Salmonella Serotypes Isolated from Minced Meat Beef, Mutton and Pork in Addis Ababa, Ethiopia. Revue Med Vet 155: 547-551. [Ref.]
- Mahmood NR, Awni DH, Dhaher FH, Jameel MM, HS Rasheed (2011) Isolation and Diagnosis of Salmonella in Animal Origin Food, Import Feed in Baghdad Local Markets and Local Poultry Farms. Iraq Acad Sci J 3: 1-19. [Ref.]
- Elsayed MS, Abdeen E, Akiela MA, Farouk T, Zahran RN (2014) Real Time and Conventional PCR for Characterization of Salmonella sp. from Imported Meat to Egypt. Adv Anim Vet Sci 2: 199-203. [Ref.]
- Libby JA, Brandly JP (1975) Meat Hygiene. 4th Edition LEA and Febiger, Cornell University, Philadelphia, USA. [Ref.]
- Escartin EF, Castillo A, Hinojosa-Puga A, Saldaña-Lozano J (1999) Prevalence of Salmonella in Chorizo and its Survival Under Different Storage Temperatures. Food microbiol 16: 479-486. [Ref.]
- Field RA, Smith FC, Denane DD, Thomas GM, Kotula AW (1977) Sources of Variation at the Retail Level in Bacteriological Condition of Ground Beef. J Food prot 40: 385-388. [Ref.]
- Sen U, Garode AM (2016) Identification and Detection of Salmonella Risk Assessment from Frozen Buffalo Meat Exported from India. J Bacteriol Mycol Open Access 2: 1-4. [Ref.]
- Rao NM, Nandy SC (1977) Organisms of Enterobacteriaceae Family Associated with Animal By-products. Indian J Anim Sci 47: 344-348.
- Nagappa K, Tamuly S, Brajmadhuri, Saxena MK, Singh SP (2007) Isolation of Salmonella typhimurium from Poultry Eggs and Meat of Tarai Region of Uttaranchal. Indian J Biotechnol 6: 407-409. [Ref.]
- Moustafa NY, Abd El-Hafiz RM, ElBahy EF (2016) Incidence of Staphylococcus aureus and Salmonella in Poultry Meat. Global Veterinaria 16: 570-578. [Ref.]
- Darwin KH, Miller VL (1999) Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin Microbiol Rev 12: 405- 428. [Ref.]
- Nucera DM, Maddox CW, Hoien-Dalen P, Weigel RM (2006) Comparison of API 20E and invA PCR for Identification of Salmonella enterica isolates from Swine Production Units. J Clin Microbiol 44: 3388-3390. [Ref.]
- Craciunas C, Keul AL, Flonta M, Cristea M (2012) DNA-based diagnostic tests for Salmonella strains targeting hilA, agfA, spvC and sef genes. J Environ Manage 95: S15-S18. [Ref.]
- Whyte P, Mc Gill K, Collins JD, Gormley E (2002) The Prevalence and PCR Detection of Salmonella Contamination in Raw Poultry. Vet Microbiol 89: 53-60. [Ref.]
- Malorny B, Hoorfar J, Hugas M, Heuvelink A, Fach P, et al. (2003) Interlaboratory Diagnostic Accuracy of a Salmonella Specific PCRbased Method. Int J Food Microbiol 89: 241-249. [Ref.]
Download Provisional PDF Here
Article Type: RESEARCH ARTICLE
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat Products. Nutr Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
Copyright: © 2019 Shaltout FA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Publication history:
