HIV and AIDS-Sci Forschen

Full Text

RESEARCH ARTICLE
Evaluation of Wantai HIV Urine Rapid Test Kit (Wantai) for the Detection of HIV Antibodies in 3 Health Facilities in Cameroon

  Bih Awazi1,2*      Joseph Fokam2-6      Collins Chenwi3      Carine Mboula1      Brenda Ngam1      Carine Ndzewiyi6      Nfor Ndamnsa3      Etienne Nchukwi3      Davidson Gintar1      Racheal Ndifor1      Kilian Songwe2,7      Marcel Tongo8      Liu Junjie9      Delemir Delev9   

1Ekoumdoum Baptist Health Center, Yaounde, Cameroon
2World Health Organisation for Africa Multilingual Expert Laboratory Trained (MELT) group, Brazzaville, Congo
3Virology Laboratory, Chantal BIYA International Reference Centre for research on HIV/AIDS prevention and management, Yaoundé, Cameroon
4Faculty of Health Sciences, University of Buea, Buea, Cameroon
5National AIDS Control Committee Cameroon
6Kribi Baptist Health Center, Kribi-Cameroon
7A Global Healthcare Public Foundation(AGHPF),Kampala, Uganda
8Centre de Recherche sur les Maladies Emergentes et Re-Emergentes (CREMER),Yaoundé, Cameroon
9Beijing Wantai Biological Pharmacy Enterprise Co. Ltd., Beijing, China

*Corresponding author: Bih Awazi, Ekoumdoum Baptist Health Center, Yaounde, Cameroon, Tel: + 237 677539151, E-mail: [email protected]; [email protected]


Abstract

Background: We evaluated for the first time in Cameroon, the performance of a rapid test that detects the presence of specific antibodies to Human Immunodeficiency Virus (HIV) in urine sample, compared to two bloods based rapid tests used for HIV screening in Cameroon. The aim of the study was twofold; [1] to evaluate the diagnostic accuracy (sensitivity and specificity) of the WANTAI HIV URINE rapid test kit (Beijing Wantai), compared to the two blood based rapid antibody tests, Determine HIV 1/2 and Ora Quick HIV-1/2, currently in use in the Cameroon national HIV testing algorithm, and [2] An HIV ‘self-test’ (HIVST) usability study using the WANTAI HIV Self-test by Urine.

Method: This was a comparative study where urine and blood specimens were collected simultaneously from each patient, tested for HIV and results of the two tests compared immediately. All interested sexually active adult patients 21yrs and above sent to the hospital laboratory for HIV test and others tests were enrolled in the study after signing an informed consent form. 330 patients opted for the HIV self-testing. All HIV positive and discordant samples were confirmed on western blood and the statistical analysis calculated using Wilson’s method. HIV sub typing was done on all confirmed HIV positive plasma samples.

Results: From November 2020 to February 2021, 1000 patients had their urine and blood Specimens tested for HIV. The test performances of both tests were as follows; Determine had a sensitivity of 100%, specificity of 98.72% and a kappa value of 0.860. Meanwhile WANTAI had a sensitivity of 100%, specificity of 99.37% and a kappa value of 0.925.

Conclusion: Both Determine and WANTAI have excellent sensitivity (>99%) and specificity (>98%) as per the WHO standards. However, WANTAI showed an overall better performance as compared to Determine, supported by an almost perfect agreement with Western Blot. In a nutshell, WANTAI therefore appears as an outstanding assay for HIV screening. Furthermore, it’s non-invasive/painless approach, its optimal privacy (i.e. reduced stigma/discrimination), and rapidity, accurate and user-friendliness makes it a significantly superior test for scaling-up HIV testing and linkage to care in resource-limited settings.

Keywords

HIV; AIDS; HTS; HIVST; Sensitivity; Specificity; Positive Predictive Value; Negative Predictive Value


Introduction

Human Immunodeficiency Virus (HIV) remains a healthcare burden to the world and Cameroon in particular. The Human Immunodeficiency Virus is a lentivirus that causes HIV infection and over time it causes Acquired Immunodeficiency Syndrome, AIDS. HIV surveillance is critical to ensuring that blood screening and diagnostic tests detect all HIV types and subtypes regardless of the geographic location [1-4], A rapid and accurate diagnosis of HIV using test kits with very high sensitivity and specificity that can be used by individuals who do not know their status and who do not have access to health care facilities in very remote areas, is important and essential for decision making prior to administration of treatment [5,6]. Most resource limited settings have shifted from an Enzyme Linked Immunosorbent Assay (ELISA) which is more expensive, to a more affordable rapid diagnostic test which can be easily transported and stored [7,8].

In this regard, there was a need to identify HIV rapid test kits that could be used for the diagnosis of HIV infection in a highly viral genetic diversified population like in Cameroon where circulating strains such as HIV -1 group M with its nine different subtypes, HIV -1 group O, HIV - 1 groups N and P and many recombinant forms such as group M/O recombinant forms, CRF01, CRF02, URF, etc. are all found [2,9,10]. Cameroon has all HIV types and a subtype, which implies that any test kit that can be used for screening in Cameroon, can also be used in any country in the world irrespective of the circulating HIV type or subtype [11,12]. The HIV prevalence for the population aged 0-14, 15-49, 15-64 years were 0.2%, 3.4% and 3.7% respectively according to the Cameroon Population Based HIV Impact Assessment 2017-2018.

In order to achieve the UNAIDS 95-95-95 global HIV target by 2025, and specifically the first target of diagnosing 95% of all people with HIV, the World Health Organization (WHO) released the consolidated guidelines on HIV testing services in 2015. In that first edition, WHO issued a recommendation to support trained lay providers to deliver HIV testing services using rapid diagnostic tests (RDTs) [13]. In particular, they highlighted the potential of HIV self-testing (HIVST) to increase HIV testing services (HTS) access, especially among general populations, pregnant and post-partum women, couples and partners, adolescents (10-19yrs old) and young people (15- 24yrs), key populations and vulnerable population.

Normally, antibodies are detected in serum or plasma samples; however, the use of body fluids other than blood such as saliva and urine as specimens for detecting antibodies to HIV has been reported to have potential as an alternative strategy for HIV testing [14-16]. The use of urine samples may be attractive because of the ease of sample collection, cost- effectiveness, increased safety (against needle injuries), and higher compliance rates. Testing of these types of specimen can be a useful alternative when it is difficult or impossible to test for HIV in blood samples.

Our research study was aimed at evaluating the sensitivity and specificity of the Wantai HIV Urine Rapid Test, a rapid test used for the detection of HIV antibodies using Urine as the tested specimen. As part of this research study, an HIV ‘self- test’ (HIVST) usability study was carried out among some of the patients using the rapid test kit, HIV Self Test by Urine. These two Wantai HIV urine rapid tests are packaged differently but have the same principle, with simple to understand instructions written and demonstrations in the inserts. Both kits were manufactured following WHO specifications. The Wantai HIV Urine rapid test uses Immunochromatography to detect HIV antibody in urine samples by indirect method. The test line of the nitrocellulose membrane coated with HIV -1 antigen and the fiberglass pad is coated with SPA protein conjugated colloidal gold. Cameroon’s national HIV testing algorithm specifies the use of two rapid blood based tests, Determine HIV 1/2 (Alere), then if positive ORA QUICK HIV 1 / 2 (OraSure Technologies, Inc.). In the case of discordant results, a third test is done preferable an Enzyme Immunoassay (ELISA) used as a tie breaker.

Methodology

Design and setting

A cross-sectional study comparing the diagnostic performance of urine based test with that of the blood based test was conducted from November 2020 to February 2021(Figure 1), among the patients attending three of our health facilities in the Cameroon Baptist Convention Ekoumdoum and Etoug Ebe in the Center region and Kribi in the South region of Cameroon. This study was approved by the ethics committee of the Cameroon Baptist Convention Institutional Review Board.

Figure 1: Clinical validation scheme.

Materials and Methods

Urine and blood specimens were collected simultaneously from each patient, tested for HIV and the results of the two tests compared immediately. All adult patients 21years and above sent to the laboratory for HIV test and others, who were interested in taking part in the research study were enrolled into the study after signing an informed consent form and completing a questionnaire with their socio- demographic information. As part of the study HIV ‘self - test‘(HIVST) usability study was carried out by 330 clients. All known HIV positive clients who were on ARV, children and adolescent of less than 21years of age were excluded from the study.

The performance of the Wantai HIV Urine rapid test was evaluated against a standard rapid test kits (Determine and Oraquick) used routinely in Cameroon in a serial testing algorithm following the Cameroon national HIV testing algorithm and the research study testing algorithm (Figure 2).

Figure 2: Research study algorithm.

10 ml (2 x 5 ml Vacutainer) of venous blood was collected into EDTA tubes from each patient and a sterile container given immediately to the same patient for urine sample collection. All urine specimens were screened immediately after collection using Wantai HIV Urine Rapid Test kit- Beijing Wantai, (REF. WZ- 1001) by the laboratory personnel. Some patients opted for HIV self-testing (HIVST) and did it independently onsite at the hospital premises using the HIV Self Test by Urine, following detailed explanation by the laboratory personnel of HIVST procedure using kit insert. This Wantai reagent presents the result within 15min, and all operations is completed on site. All blood samples were screened using Determine HIV 1/ 2 rapid test (Alere, Lot: 06539k200A, Exp; 2021 -09-30) with specificity of 97.96% and sensitivity of 99.91%. Patients whose urine samples were reactive on WANTAI Urine RDT, and blood samples reactive on Determine RDT, had their plasma samples screened on Ora Quick rapid test (OraSure Technologies, Inc ; Lot: HIVCO – 8421 Exp: 26/06/2021) with specificity of 99.87% and sensitivity of 100.0%. All plasma samples irrespective of their rapid test results, were screened using a 4th Generation ELISA test, HIV 1+2+0 Ag/Ab 4th Generation by Beijing Kewei Clinical Diagnostic Reagent. INC, Exp: 2021/06/19) with specificity of 99.32% and sensitivity of 100%. Positives and discordant results were confirmed using GeeniusTM HIV 1/2 confirmatory Assay (REF 72460) with sensitivity of 100% and specificity of 100%. All samples were collected and screened by laboratory personnel in the different hospitals where study was carried out. HIV sub typing was done in a research laboratory, on all HIV positive samples identified in the study.

It is important to note that, patients who took the HIVST kit home never came back with the results to the hospital, for this reason an area was allocated specifically for HIVST onsite in the hospital. There was conformity in the test results when inspecting the Wantai HIVST result done by HIVST patients to that done by the laboratory personnel.

Viral extraction, nef gene amplification and phylogenetic analysis

Given the potential impact of HIV-1 diversity on diagnosis, we have decided to determine the distribution of the different HIV-1 lineages in our cohort. RNA was extracted manually from plasma samples using QIAampTM Viral RNA (Roche). HIV nef complementary DNA (cDNA) were generated using the Invitrogen ThermoscriptTM RTPCR system (Invitrogen). cDNA from the RT step was PCR amplified using non-specific HIV-1 primers for HIV-1 full length nef genes. The amplified nef genome fragments produced 700 kb sequences spanning the entire nef region. PCR was performed using the Expand High Fidelity kit (Roche-Mannheim). The first and second round reactions were performed using 1ul dNTP (10mM), 5ml 10X buffer plus MgCl2 (15mM), 1ul of each primer (10mM), 0.75ul Expand High Fidelity Enzyme (5U/ul), water and template, in 50ul total reaction volume with no hot-start method.

The cycling conditions were the same for both first and second round, consisting of 94℃ 2 min followed by 35 cycles of 94℃ 15s, 55℃ 15s, 72℃ 50s and then 72℃ 7 min. The nef first round primers were: Nef outer5- Ie (HXB2: 8513-8533; 5’–GTGCCTCTTCAGCTACCACCG) and Nef outer3-3e (HXB2: 9808-9488; 5’–AGCATCTGAGGGTTAGCCACT). The nef second round primers were (HXB2: 8698-8717; 5’-) and (HXB2: 9467-9448; 5’-). All sequences had at least two clear readings in each direction for completion.

Full length nef sequences were generated, together with a representative selection of nef HIV sequences available in the Los Alamos National Library (LANL; http://hiv-web.lanl.gov/content/hivdb) databases (May 2021). These were aligned using MUSCLE [17] with default settings and manual editing of alignments in MEGA5. The representative sequences chosen to include the broadest diversity of sequences previously identified as belonging to known HIV-1 group M subtypes and CRFs. This was achieved by constructing maximum likelihood trees from all available nef sequences for each subtype and CRF, and selecting one sequence from each of the up to ten most basal lineages from the root of these subtypes and CRFs. Maximum likelihood (ML) phylogenetic trees were constructed from these sequences with 500 full ML bootstrap replicates implemented in MEGA5using default settings. The tree was rooted using HIV-1 group P isolates.

Result

Study Population

From November 2020 to February 2021, 1000 patients had their urine and blood specimens collected and tested simultaneously for HIV using the WANTAI and Determine rapid diagnostic tests. The performance of both tests were compared to western blot as the gold standard. As part of the study 330 clients opted for the HIV self-testing using WANTAI HIV self test.

Assessment of attitudes and feasibility of urine rapid test

All information was obtained through direct face-to-face interviews. Patients were consented by obtaining their written informed consent for voluntary rapid urine testing and participation in the pre oral test questionnaire. Patient’s socio demographic information was collected, information on sex, age, HIV testing histories, level of education, number of sexual partners, profession, advantages and disadvantages of conducting HIV testing using urine and willingness to conduct HIV ‘self - test’ were collected in the questionnaires. A total of 392 men (39.2%) and 608 females (60.8%) participated in the study with an average age of 33years (Figure 3). Minimum age was 21yrs and maximum was 80years (Figure 4).

Figure 3: Number of Males/Females who took part in the survey.

Figure 4: Age Range of participants in the survey.

Their educational level was as follows; illiterates 3 (0.3%), some primary school 189 (18.9%), some secondary 523 (52.3%), Diploma 15 (1.5%), University 270 (27.0%). 693 (69.3%) had at least one sexual partner with 72 (7.2%) having three or more sexual partners. Their knowledge of using urine for HIV testing was also noted in all the different level of education. The collected information showed that more than 90% of patients had no idea about HIV testing using urine (Figure 5).

Figure 5: Response from the participants on the knowledge of using urine for HIV testing.

From the questionnaire we gathered that only approximately 13% of patients were aware of HIV self - testing, 87% had no idea that an individual could conduct HIV testing independently at home away from a health center (Figure 6).

Figure 6: Knowledge of HIV self-testing.

From the responses on the advantages of HIV self-testing, 48% of the participants selected privacy/confidentiality as an advantage which was highest over the other options mainly because it is done privately. This says a lot about the success of reducing stigmatization in Cameroon (Figure 7).

Figure 7: Response from participant to the advantages of HIV selftesting.

Key: 1. SM: Saves money, no transport fare needed to go to the hospital 2. ST: Saves time, no long lines in the hospital 3. P/C: Privacy/ Confidentiality 4. Being in charge: Taking charge of one’s health 5. No Adv: I don’t see any advantage 6. Others: Other response.

For the questions on the disadvantages, many participants selected the response on difficulties in performing and interpreting results, this was highest with 37% compared to the other options (Figure 8).

Figure 8: Response from participants to the disadvantages of HIV self-testing.

Key: 1. Diff in P&I: Difficulties in Performing and Interpreting the results 2. No Counselor: No counselor when testing 3. Reduced chance of E&C: Reduced chance of Enrollment in Care 4. No Disadv: I don’t see any disadvantage 5. Others: Other responses

Survey on instructions for use and labels

A survey was conducted among 300 participants to evaluate the level at which they could read the kit insert or just follow the illustrations using the diagrams, understand, conduct the HIV test by themselves and interpret the results of the Wantai HIV Self Test by Urine (Figure 9).

Figure 9: Participants who read and understood the information on the instructions for use and labels.

A total of 122 men and 178 females took part in the survey with an age range of 21years to above 70years. The highest numbers of patients were having secondary education and some from the university, one patient was an illiterate (Figure 10).

Figure 10: Level of Education.

The single illiterate who could not read was able to follow the illustrated diagrams in the leaflet, perform the test and interpret the results correctly under the supervision of the laboratory personnel. Only 14 out of the 300 clients had a profession that was related to the medical field (Figure 11).

Figure 11: Participants whose profession is related to Medical Health.

So all those who took part in the survey were able to perform the test and interpret the test results despite the difference in their level of education (Figure 12).

Figure 12: Number of participants who were able to complete the test and interpret the results by themselves.

The overall score rating for the survey was over 95% which shows that, this WANTAI HIV urine test kit is a very superior kit which is easy to use, painless, rapid and user friendly (Figure 13).

Figure 13: Participants ’Final Score.

It can be adopted for use as a screening test for HIV testing strategy worldwide and especially in resources limited settings. To be able to achieve the first 95% UNAIDS target, the WANTAI HIV urine test kit is highly recommended.

Test performance

The test performance of both tests were as follows; Determine had a sensitivity of 100%, specificity of 98.72% and a kappa value of 0.860. Meanwhile Wantai had a sensitivity of 100%, specificity of 99.37% and a kappa value of 0.925. Of the 300 surveys related to the understanding of the instructions for use and labels, scores above 90 points accounted for 95.33% of the total. The results of the present study are summarized in the tables below.

Only HIV positive and discordant samples were confirmed using Western blot. The Wantai study samples were screened following the national HIV testing algorithm used for HIV diagnosis in Cameroon where, only HIV positive or discordant samples are confirmed using western blot test. HIV negative samples are not screened using western blot.

Determine vs Result of blood test

“Result of blood test” refers to blood testing procedures of “Methodology- Research study algorithm”. The patient’s HIV infection status can be confirmed through these testing procedures (Table 1).

Result of blood test
Present Absent Totals
Determine Test Positive 39 12 51
Determine Test Negative 0 928 928
Totals 39 940 979

 

Estimated Value (%) Confidence interval (95%)

 

Lower limit Upper limit
Prevalence 4.00 2.90 5.40
Sensitivity-Determine 100 88.83 100.00
Specificity- Determine 98.72 97.72 99.31
PPV- Determine 76.47 62.18 86.75
NPV – Determine 100.00 99.49 100.00

Table 1: Determine vs Result of blood test.
Confidence interval calculated by Wilson method

Kappa coefficient (Determine/Western Blot) 0.860 [0.772-0.860]: Excellent kappa

Kappa interpretation: ≥ 0.8 indicates a strong agreement between the two tests.

Result interpretation:

- The sensitivity of Determine was 100%, which falls within the acceptable performance for an HIV screening test (i.e. sensitivity >99% as per the WHO recommendations).

- The specificity of Determine was 98.72%, which falls within the acceptable performance for an HIV screening test (i.e. sensitivity >98% as per the WHO recommendations).

- The Kappa value between Determine and Western Blot was 0.860, indicating a strong agreement between the 2 tests.

Wantai vs Result of blood test

“Result of blood test” refers to blood testing procedures of “Methodology- Research study algorithm”. The patient's HIV infection status can be confirmed through these testing procedures (Tables 2-4).

  Result of blood test Totals
  Present Absent
WANTAI Test Positive 39 6 45
WANTAI Test Negative 0 941 941
Totals 39 947 986
Estimated Value (%) 95% Confidence interval
Lower limit Upper limit
Prevalence 4.00 2.9 5.4
Sensitivity-WANTAI 100.00 88.83 100.00
Specificity- WANTAI 99.37 98.55 99.74
PPV- WANTAI 86.67 72.51 94.46
NPV – WANTAI 100.00 99.49 100.00

Table 2: Wantai vs Result of blood test.
Kappa coefficient (WANTAI/WesternBlot) 0.925 [0.838-0.925]: Excellent kappa

Kappa interpretation: >0.9 indicates an almost perfect agreement between the two tests

Result interpretation:

- The sensitivity of WANTAI was 100%, which falls within the acceptable performance for an HIV screening test (i.e. sensitivity >99% as per the WHO recommendations).

- The specificity of WANTAI was 99.37%, which falls within the acceptable performance for an HIV screening test (i.e. sensitivity >98% as per the WHO recommendations).

- The Kappa value between WANTAI and Western Blot was 0.925, indicating an almost perfect agreement between the 2 tests.

Professional testing Totals
Positive Negative
Positive Self-testing 15 0 15
Negative Self-testing 0 315 315
Totals 15 315 330
Estimated Value (%) 95% Confidence interval
Lower limit Upper limit
Positive Self-testing Agreement rate 100.00 79.61 100.00
Negative Self-testing Agreement rate 100.00 98.80 100.00

Table 3: WANTAI self-testing vs professional testing.
Kappa coefficient (WANTAI self-testing/professional testing) 1 [ 1-1 ]: Excellent kappa

Result interpretation:

- Among the 15 specimens that were positive with professional testing, positive agreement rate of self-test patients was 100.00%.

- Among the 315 specimens that were negative with professional testing, negative agreement rate of self-test patients was 100.00%.

- The Kappa value between WANTAI professional testing and selftesting was 1, indicating an Excellent agreement between the 2 tests (Table 3).

Determine Total
Present Absent
WANTAI Test Positive 39 5 44
WANTAI Test Negative 24 927 951
Totals 63 932 995

Table 4: Determine vs Wantai.
Kappa coefficient (WANTAI/Determine) 0.714 [0.615 -0.813]: Excellent kappa

Result interpretation:

--The coincidence rate of positive detection with WANTAI reagent was 61.90%. Combined with the blood test results of the fourth generation enzyme immunoassay and WB reagent,12 of the 63 positive samples detected by Determine reagent were false positive, and all the 12 samples detected by Wantai reagent were negative

-- The negative coincidence rate of Wantai reagent was 99.46%. Among the 932 negative samples detected by Determine, 5 false positive samples were detected by Wantai reagent.

--The Kappa value between WANTAI and Determine was 0.714, indicating an excellent agreement between the 2 tests (Table 4).

HIV-1 Genetic Diversity

Thirty (30) full length HIV-1 nef genes were amplified from 39 HIVinfected individuals. Out of these 30, 23 were successful sequenced. All sequences were derived from HIV-1 group M (HIV- 1M) viruses. The sequences clustered with some different subtypes and CRFs, an observation that is consistent with the breadth of HIV-1 diversity previously described in Cameroon.

As expected, CRF02_AG-like viruses (from participants EB11, EK207, EK599, EK63, K155, K139, K13, EK64, EB14, EB50, EB59) dominated the subtype distribution, infecting 48% of the 23 participants for which nef genes were sequenced (Figure 1). Participants infected with viruses having nef sequences that clustered within known HIV1group M subtypes also included those belonging to subtypes G (EK255, EB49), D (K115), and F2 (K19, EK150); notably, a subtype C virus (from participant EK156) was identify in this study. Subtypes G and F2 sequences accounted for 9% each of infections, while subtypes C and D for 4%. In addition to CRF02_AG, other CRFs identified were CRF06_cpx (4%; from participants EK642) and CRF22_01AE (13%; from participants EK456, K148, EK482). Two (9%) unique recombinant forms were also identified and from participants EK372 and EK159.

Discussion

In the present study, we evaluated the applicability of Wantai HIV Urine rapid test that uses urine as samples compared to Determine, which is a blood, based rapid test, among patients attending three hospitals in Cameroon. All known HIV positive patients were excluded from the study, Both Determine and WANTAI had excellent sensitivity (>99%) and specificity (>98%) as per the WHO standards. However, Wantai showed an overall better performance as compared to Determine, supported by an almost perfect agreement with Western Blot. Wantai was able to detect antibodies to HIV-1 group M with its nine different subtypes, many recombinant and unique recombinant forms. Our study results showed that Wantai correctly identified 39 true positive patients and for 22 of these patients, HIV subtyping revealed 15 CRF’s, 1 URF, 1 subtype D, 1 subtype C, 2 subtype G and 2 subtype F2. We also had 2 samples of HIV 1 and 2 co infection. The reactive band most frequently observed were, p24, p31, gp41, gp 160 for HIV -1 and gp 140 for HIV -2. This study also confirms the existence of HIV genetic diversity in Cameroon which was stated in other studies done before now [2-4]. WANTAI can be used for the diagnosis of HIV infection in a highly viral genetic diversified population like Cameroon and in any other part of the world.

In another study conducted in China using urine HIV antibody rapid test reagent with colloidal gold method, results showed satisfactory sensitivity, specificity and ROC curves, especially in highrisk populations such as persons with Injection Drug Users (IDU) and Female Sex Workers (FSWs). Commercial heterosexual infections were the main transmission route of HIV infection [18]. Several other studies have been conducted around the world using urine as sample but with ELISA technique (Enyzme-Linked Immunosorbent Assay) [14,16,19-21]. ELISA is the major approach to test for HIV antibodies, which requires the collection of venous whole blood samples from patients or people in the general population and transportation to a dedicated laboratory where HIV screening can be done especially in resource poor setting with limited health facilities. In contrast, urine testing offers greater advantages in terms of convenience and timeliness.

Conclusion

In summary, WANTAI HIV urine rapid test kit therefore appears as an outstanding assay for HIV screening. Furthermore, it’s noninvasive/painless approach, its optimal privacy (i.e. reduced stigma/ discrimination), rapidity, accurate and user-friendliness makes it a significantly superior test for scaling-up HIV testing and linkage to care in resource-limited settings and in the developed world. Adopting it may help to further increase the acceptance of the population to HIV screening. We conclude that urine is comparable to serum for assessing HIV antibodies in individuals for surveillance and screening purposes.

Ethics Approval and Consent to Participate

This study was approved by the ethics committee of the Cameroon Baptist Convention Institutional Review Board.

Consent for Publication

Not applicable.

Availability of data and Material

The data and materials are available on request.

Competing Interests

There are no competing interest.

Funding

Beijing Wantai Biological Pharmacy Enterprise Co. Ltd. Beijing China.

Authors Contributions

• Bih Awazi wrote the study protocol, enrolled participants, collected and analysed sample and wrote the first manuscript draft.

• Joseph Fokam, Collins Chenw and Racheal Ndifor did the statistical analysis.

• Carine Mboula, Brenda Ngam, Carine Ndzewiyim, Nfor Ndamnsa, Etienne Nchukwi, Davidson Gintar, collected and analysed samples.

• Kilian Songwe wrote the draft manuscript.

Marcel Tongo performed molecular analysis and wrote the draft manuscript.

Liu Junjie and Delemir Delev design the study and facilitated the funding.

All authors have read and accepted the manuscript.

Acknowledgements

• Beijing Wantai Biological Pharmacy Enterprise Co. Ltd. Beijing CHINA for sponsoring the research study.

• The staff of the Ekoundoum, Kribi and Etoug-Ebe Baptist Health Centers.

The administration of the Cameroon Baptist Convention Health Board Services.


References

  1. Brennan CA, Lund JK, Golden A, Yamaguchi J, Vallari AS, et al. (1997) Serologic and phylogenetic characterization of HIV-1 subtypes in Uganda. AIDS 11: 1823-1832.
  2. Brennan CA, Bodelle P, Coffey R, Devare SG, Golden A, et al. (2008) The prevalence of diverse HIV-1 strains was stable in Cameroonian blood donors from 1996 to 2004. J Acquir Immune Defic Syndr 49: 432-439.
  3. Vergne L, Bourgeois A, Mpoudi-Ngole E, Mougnutou R, Mbuagbaw J, et al. (2003) Biological and genetic characteristics of HIV infections in Cameroon reveals dual group M and O infections and a correlation between SI-inducing phenotype of the predominant CRF02_AG variant and disease stage. Virology 310: 254-266.
  4. Dambaya B, Fokam J, Ngoufack ES, Takou D, Santoro MM, Této G, et al. (2020) HIV-1 Drug Resistance and Genetic Diversity among Vertically Infected Cameroonian Children and Adolescents. Explor Res Hypothesis Med 5: 53-61.
  5. Yamaguchi J, Bodelle P, Vallari AS, Coffey R, McArthur CP, et al. (2004) HIV infections in northwestern Cameroon: identification of HIV type 1 group O and dual HIV type 1 group M and group O infections. AIDS Res Hum Retroviruses 20: 944-957.
  6. Aghokeng AF, Ewane L, Awazi B, Nanfack A, Delaporte E, et al. (2004) Evaluation of four simple/rapid assays and two fourth-generation ELISAs for the identification of HIV infection on a serum panel representing the HIV-1 group M genetic diversity in Cameroon. J Acquir Immune Defic Syndr 37: 1632-1640.
  7. Haleyur Giri Setty MK, Hewlett IK (2014) Point of Care Technologies for HIV. AIDS Res Treat 2014: 497046.
  8. Manoto SL, Lugongolo M, Govender U, Mthunzi-Kufa P (2018) Point of Care Diagnostics for HIV in Resource Limited Settings: An Overview. Medicina (Kaunas) 54: 3.
  9. Godwe C, Goni OH, San JE, Sonela N, Tchakoute M, et al. (2024) Phylogenetic evidence of extensive spatial mixing of diverse HIV-1 group M lineages within Cameroon but not between its neighbours. Virus Evol 10: veae070.
  10. Peeters M, Gueye A, Mboup S, Bibollet-Ruche F, Ekaza E, et al. (1997) Geographical distribution of HIV-1 group O viruses in Africa. AIDS 11: 493-498.
  11. Rodgers MA, Vallari AS, Harris B, Yamaguchi J, Holzmayer V, et al. (2017) Identification of rare HIV-1 Group N, HBV AE, and HTLV-3 strains in rural South Cameroon. Virology 504: 141-151.
  12. Yamaguchi J, Vallari A, Ndembi N, Coffey R, Ngansop C, et al. (2008) HIV type 2 intergroup recombinant identified in Cameroon. AIDS Res Hum Retroviruses 24: 86-91.
  13. Consolidated Guidelines on HIV Testing Services: 5Cs: Consent, Confidentiality, Counselling, Correct Results and Connection 2015. Geneva: World Health Organization; 2015.
  14. Cruz Sui O, Pérez Guevara MT, Lubián Caballero AL, Montano Tamayo L, Silva Cabrera E (2007) Fluido oral y orina como muestras alternativas en el diagnóstico confirmatorio de la infección por VIH- 1 [Oral fluid and urine as alternative samples in confirmatory testing of HIV-1 infection]. Rev Cubana Med Trop 59: 134-138.
  15. Berrios DC, Avins AL, Haynes-Sanstad K, Eversley R, Woods WJ (1995) Screening for human immunodeficiency virus antibody in urine. Arch Pathol Lab Med 119: 139-141.
  16. Oelemann WM, Lowndes CM, Veríssimo Da Costa GC, Morgado MG, Castello-Branco LR, et al. (2002) Diagnostic detection of human immunodeficiency virus type 1 antibodies in urine: a brazilian study. J Clin Microbiol 40: 881-885.
  17. Edgar RC (2004) MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5: 113.
  18. Lu H, Chen H, Liang S, Zhu Q, Tan G, et al. (2024) Diagnostic performance evaluation of urine HIV-1 antibody rapid test kits in a real-life routine care setting in China. BMJ Open. 14: e078694.
  19. Almeda J, Casabona J, Matas L, González V, Muga R, et al. (2004) Evaluation of a commercial enzyme immunoassay for HIV screening in urine. Eur J Clin Microbiol Infect Dis 23: 831-835.
  20. Taye B, Woldeamanuel Y, Kebede E (2006) Diagnostic detection of human immunodeficincy virus type-1 antibodies in urine, Jimma Hospital, south west Ethiopa. Ethiop Med J 44: 363-368.
  21. Holm-Hansen C, Constantine NT, Haukenes G (1993) Detection of antibodies to HIV in homologous sets of plasma, urine and oral mucosal transudate samples using rapid assays in Tanzania. Clin Diagn Virol 1: 207-214.

Download Provisional PDF Here

 

Article Information

Article Type: RESEARCH ARTICLE

Citation: Awazi B, Fokam J, Chenwi C, Mboula C, Ngam B, et al. (2025) Evaluation of Wantai HIV Urine Rapid Test Kit (Wantai) for the Detection of HIV Antibodies in 3 Health Facilities in Cameroon. J HIV AIDS 9(1): dx.doi.org/10.16966/2380-5536.195

Copyright: ©2025 Bih Awazi, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Publication history: 

  • Received date: 14 Feb, 2025

  • Accepted date: 03 Mar, 2025

  • Published date: 10 Mar, 2025
  •